/b/

General

Me cagué
Descarga NidoDownloader
Regresar Bajar Catálogo Recargar
Opcional
Funciones disponibles:
Opcional
Funciones disponibles:
Opcional.
Largo máximo del post: 18000 caracteres.
Permite BBCode.
No permite HTML.
Recuerda leer las reglas y el FAQ antes de postear.
Requerido.
Colocar url completa del video.
Sitios soportados:
Requerido
Ingresa el código de verificación para poder iniciar un nuevo hilo en este board.
No distingue entre mayúsculas y minúsculas.
Ingresa una contraseña para poder eliminar el post.
Opciones habilitadas solo para el staff.
Opciones adicionales para agregar a tu hilo/post.
Opcional
Hasta 12 opciones para agregar.
En desarrollo
Nombre
Email
Mensaje
Archivo
Incrustar
Contraseña
Opciones
Donar
Apps
Proyectos
Catálogo
Noticias
Respondiendo 231
X
Nombre
Email
Mensaje

Opciones
Opciones
Contraseña
Pornpremium: Estrangula el Ganso con placer! – El ganso no tendra descanso
Pornpremium: Estrangula el Ganso con placer! – El ganso no tendra descanso

Archivo: nido.org_1536430038191.webm (2.15 MB, 352×640px, 11:20, 1420d63f3cecf807118d431963e3028ce29796a756a8fc55ce765bc9de8cf724.webm)

3568296

hilo de videos jajiantinhos
jajiantes,videos,

3568308

NAO PODE SEEEEEEEEEEE

3568310

Archivo: nido.org_1536430488065.jpg (37.51 KB, 226×400px, 113:200, 11535164690280.jpg)


3568313

Archivo: nido.org_1536430629256.jpg (12.59 KB, 236×362px, 118:181, 1507168271522.jpg)

>cabecea un rio

3568317

Archivo: nido.org_1536430788463.gif (1.74 MB, 177×150px, 59:50, nido.org_1511285504877.gif)


3568340

>no revisar la profundidad y ver si hay piedras o escombros primero
darwin awards.

t. huaso que saltaba de un puente a como 30 metros de altura al rio todos los dias uyyyuuuyy

3569780

Archivo: nido.org_1536524552665.webm (1.82 MB, 640×360px, 16:9, 404221af633996619548dd25fc6c3a599521d077a6c6ceeb5ec33d1ed073856c.webm)


3569791

Archivo: nido.org_1536525055519.mp4 (832.57 KB, 360×360px, 1:1, when lucio get the potg.mp4)

falto que otro negro se tirara a ayudarlo y le pasara lo mismo

3569804

Archivo: nido.org_1536525361834.webm (3.95 MB, 640×360px, 16:9, 08960e19141a1928daad2756600f9d7a667ad756d5383273cf65cc17e2c1c1e5.webm)


3569808

>>3569804
Tremendo largometraje conchetumare

3569809

>>3569804
KEEEEEEK

3569812

Archivo: nido.org_1536526150812.png (215.79 KB, 861×861px, 1:1, 15140958577.png)

>>3569804
lolie horrible

3569814

>>3569804
tenía que ser mujer

3569824

>>3569791
kek, esos animales son tan livianos que no les pasa nada al caer desde varios metros de altura, por ejemplo las iguanas, las he visto saltar de como 15 metros de altura desde la copa de un arbol, pegarse sendo guatazo en el piso y salir corriendo.

3569826

ufff.png
(638x358px, 439.95 KB)
ufff2.png
(640x359px, 446.98 KB)
ufff3.png
(640x360px, 448.43 KB)

>>3569804
ufff potito riiiico

3569828

 Eres un Imbécil - Héctor Reyes (Los Reyes de la Colina)

3569835

 Mario Filio actor de doblaje y locutor comercial.
>>3569828
Este ahora es un hilo de doblaje.

3569843

>>3568296 (OP)
[sp]UMA DELICIA[/SP]

3569846

Archivo: nido.org_1536528925017.jpg (47.77 KB, 588×600px, 49:50, jajajaj.jpg)

>>3569804
CARCAJEÉ con esta wea, pero lo que aun no entiendo, ¿qué intentaba hacer la culiá en los ductos?

3569852

Archivo: nido.org_1536529122442.png (103.38 KB, 490×410px, 49:41, 1429419171824_n.png)

>>3569846
arrancar de los pacos

3569884

>>3569804
me hiciste el dia ctm!

3569890

>>3569884
Qué penca tu vida entonces.

3569894

>>3569826
Tenía que salir el virginazo.

3569941

Archivo: nido.org_1536532190697.mp4 (2.76 MB, 640×360px, 16:9, 1.mp4)


3569961

Archivo: nido.org_1536533558943.webm (1.21 MB, 222×400px, 111:200, bf5bc432ff9270b76b5b257585ed118936bb4089c31d7bbf702d1187b0082458.webm)


3570021

>>3569941
SE ME PARO BRIGIDO

3570048

>>3569826
cultura.

3570157

Archivo: nido.org_1536540666537.mp4 (4.22 MB, 1280×720px, 16:9, 70a2fd59791637753b01cd9f6c851b66d257e4457a88a97bae156ea626a579e6.mp4)

que no pare el jajeo

3570164

>palfeis
<0 resultados
Hilo culiao malo - Thread fucking wrong

3570166

Archivo: nido.org_1536540860499.jpeg (6.13 KB, 128×217px, 128:217, received_385919645091741.jpeg)

>>3570157
Puta que es fome ese deforme culiao, cuando se muere wn, es chistoso reirse de los discapacitados, no con ellos.

3570169

>>3570166
y bosnia

3570175

Archivo: nido.org_1536541069475.webm (1.62 MB, 1000×640px, 25:16, miles.webm)


3570194

 Robert Miles - Children [Dream Version]
>>3570175
Jajié.

3570391

Archivo: nido.org_1536547077349.mp4 (1.13 MB, 640×360px, 16:9, 08.mp4)


3570404

Archivo: nido.org_1536547313578.mp4 (296.97 KB, 304×400px, 19:25, 01.mp4)


3570407

Archivo: nido.org_1536547393732.jpeg (57.78 KB, 550×496px, 275:248, 8493bd009d089f894bbb06d7da04b466f8038ff7235635e039518444eededc60.jpeg)

>>3570404
que te pasa enfermo conchatumadre

3570408

Archivo: nido.org_1536547417894.webm (4.87 MB, 640×352px, 20:11, 02.webm)


3570411

Archivo: nido.org_1536547481175.mp4 (1.71 MB, 450×800px, 9:16, 03.mp4)


3570414

Archivo: nido.org_1536547578576.webm (828.96 KB, 178×320px, 89:160, 04.webm)


3570415

suban en el de la pendeja q sea pelea cn su vieja

3570421

Archivo: nido.org_1536547661416.mp4 (2.07 MB, 176×320px, 11:20, 07.mp4)


3570422

Archivo: nido.org_1536547664022.png (41.46 KB, 160×160px, 1:1, nido.org_1526355958462.png)

>>3570175
Kek, reí más de lo debido

3570424

Archivo: nido.org_1536547694554.webm (1.96 MB, 640×360px, 16:9, disparo.webm)


3570425

Archivo: nido.org_1536547754758.webm (2.02 MB, 240×278px, 120:139, 13.webm)


3570432

Archivo: nido.org_1536547849500.mp4 (147.55 KB, 400×400px, 1:1, nido.org_1512507881997.mp4)


3570441

Archivo: nido.org_1536548043442.jpg (15.69 KB, 316×252px, 79:63, _1535144437349.jpg)

>>3570175
Conchetumare yo en cada festividad.
kekié como simio con el in crescendo del tema

3570468

Archivo: nido.org_1536548599197.mp4 (1.49 MB, 640×640px, 1:1, negro_tonto.mp4)


3570474

Archivo: nido.org_1536548766033.mp4 (3.36 MB, 640×360px, 16:9, 40148029_293911224527650_7690528317815619116_n.mp4)


3570477

>>3570468
>negro_tonto
y si era una especie de ritual para entrar a alguna mafia/grupo de narcos

3570480

>>3570474
TA TOO GRABAOOO

3570483

Archivo: nido.org_1536548961767.webm (1.78 MB, 360×640px, 9:16, 1509229393584.webm)


3570485

>>3570477
Lo cambiaria a negro_imbecil.mp4

3570490

Archivo: nido.org_1536549090873.webm (906.42 KB, 1280×720px, 16:9, smash is not a fighting game.webm)


3570491

Archivo: nido.org_1536549116008.jpg (55.25 KB, 634×650px, 317:325, jjkjkjkj.jpg)

>>3570474
ME ESTAS WEBIANDO QUE ESE BOOMER CULIAO SE VISTIÓ DE ESA MIERDA??? NO TE CREO, QUE AWEONAO.

3570492

Archivo: nido.org_1536549122686.webm (1.49 MB, 330×480px, 11:16, 1512871445641.webm)


3570498

Archivo: nido.org_1536549228482.webm (2.97 MB, 280×420px, 2:3, nido.org_1513119216800.webm)


3570499

Archivo: nido.org_1536549276188.webm (9.7 MB, 384×288px, 4:3, nido.org_1510713176856.webm)

Me gustan los hilos webm.

3570501

Archivo: nido.org_1536549317351.webm (1.81 MB, 720×404px, 180:101, 1506465059643.webm)


3570505

>>3570492
Futura esclava sexual.

3570507

>>3570474
>NO LO GRABÉ CONCHETUMARE
literalmente yo cada vez que pasa algo.

3570513

Archivo: nido.org_1536549803084.mp4 (204.21 KB, 400×226px, 200:113, 18967731200.mp4)


3570522

Archivo: nido.org_1536550331574.mp4 (2.84 MB, 400×224px, 25:14, 14342247424.mp4)

Imaginen el olor a aleta.

3570525

>>3570474
jajie.

3570531

 Pepe Tapia

3570532

>>3570492
¿Cómo es que se ve tan relajada?

3570535

>>3570532
>que es aceptar la muerte

3570539

>>3570531
16.208.850-5

3570551

>>3570532
el shock

3570556

>>3570532
Si es hindú, entonces entiende que su situación es consecuencia de sus malas acciones en vidas pasadas, el karma. Sabe que una vez muerta reencarnará, tal vez en una criatura de menor jerarquía luego de haber pasado los infiernos correspondientes, pero reencarnará a la larga.

3570562

>>3570522
¿y el mosh?

3570563

Archivo: nido.org_1536552295856.webm (1.47 MB, 352×640px, 11:20, Jewish kick.webm)


3570565

>>3570563
>grabado por un cuervo

3570568

Archivo: nido.org_1536552618277.webm (2.55 MB, 1280×720px, 16:9, b013df47119779f21f91d85b60170fc31a04d147d033c6a98ae9bee0c4e1dd02.webm)


3570573

>>3570522
CONCHATUMADRE LA WEA PATETICA Y RETRASADA

3570578


3570582


3570584

>>3570573
¿Cuántas familias disfuncionales hay ahí?

3570586

>>3570474
puta que es gritona la culiá

3570587

Archivo: nido.org_1536553719243.jpg (8.84 KB, 259×194px, 259:194, descarga.jpg)

>>3570404
El cohete perrito, el cohete

3570588

>>3570586
A pesar de gritar el microfono genius transmite como las hueas.
me dan penita esos eventos pobres

3570589

>>3570522
>>3570474
Si ser weeaboo es súper normal y aceptable po, ¿verdad?

3570597

Archivo: nido.org_1536554645639.mp4 (3.01 MB, 854×480px, 427:240, completito.mp4)


3570601

>>3570597
>la vida en la pobla

3570605

>>3570597
pobre cabro por la chucha esta como las weas por que no ahí minas

3570609

Archivo: nido.org_1536555094058.mp4 (1.49 MB, 400×400px, 1:1, mamagueo.mp4)

>chile 2021

3570613

Archivo: nido.org_1536555360751.webm (7.8 MB, 1280×720px, 16:9, OTB5L1b.webm)


3570614

>>3570613
meo show y el tres ni sintio el choque.

3570615

>>3570614
Qué es descarrilar.

3570616

Archivo: nido.org_1536556044380.jpg (48.96 KB, 253×317px, 253:317, 4wG9N.jpg)

>>3570614
Puta el hueón idiota.

3570617

>>3570616
walter hugo andate nadie te quiere

3570618

Archivo: nido.org_1536556137716.webm (2.55 MB, 1000×563px, 1000:563, 1535748113203.webm)


3570620

>>3570615
hay como mil videos de trenes chocando camiones atravesados en la vía y un no e visto que uno se descarrile.

3570622

>>3570620
aqui te traigo uno bro

3570625

Archivo: nido.org_1536557103345.webm (1.52 MB, 842×454px, 421:227, nido.org_1522896126998.webm)


3570637

Archivo: nido.org_1536557984979.mp4 (4.64 MB, 544×408px, 4:3, nido.org_1527979230641.mp4)


3570645

>>3570625
Doble Kill

3570649

>>3570625
El camión por sí solo no descarrila un tren, pero sí lo puede empujar lo suficiente como para que choque con otro tren en dirección contraria. Por eso se descarrila.

3570651

Archivo: nido.org_1536559154285.jpg (4.2 KB, 221×250px, 221:250, 4wG9N1.jpg)

>>3570649
Llegó valentín el autista.

3570655

>>3570649
no me diga

3570754

>>3569890
mi vida es un dolor interminable

3570788

>>3570175
Me pasa lo mismo, solamente que me desquito al dia siguente en la mañana conectando el PC a la TELE full volumen jugando mis jueguitos.

3570820

Archivo: nido.org_1536589899792.gif (991.81 KB, 250×250px, 1:1, chuckle.gif)


3570915

Archivo: nido.org_1536595461537.webm (712.75 KB, 460×464px, 115:116, jhonny.webm)


3571487

Archivo: nido.org_1536620174513.webm (1.42 MB, 640×350px, 64:35, 4ddcd831ab5aa80dc1094766631373fd2a69a28fee2a544d0f450e35b59a0320.webm)


3571493

>>3571487
Ahí quedó el guatón culiao alucinao KEK

3571843

Archivo: nido.org_1536630444564.webm (2.03 MB, 1280×720px, 16:9, bfae8fd9d1b352cf3c14d4c7fbb12ec5a737c856aeeea74572472a5932c6a543.webm)


3573016

Archivo: nido.org_1536706308443.mp4 (4.04 MB, 1280×720px, 16:9, d0afa79734628e1d244c7268c195346282958bfbf5099d42dee698777b7605eb.mp4)


3573031

>>3570915
Ese filthy frank en la pasta kek

3573063

Archivo: nido.org_1536707521115.webm (3.32 MB, 460×258px, 230:129, eeb58ae86d0aa2c85bd7ec7ba3b81ce3cc5d8769901fced7e299a78d68a0ecbf.webm)


3575068

Archivo: nido.org_1536806967641.webm (1.45 MB, 640×358px, 320:179, 333d4edfc319d2f6db9e64ae9567ce3e4431a66387a02ce3de45102937c50484.webm)


3575090

Archivo: nido.org_1536807458222.webm (3.21 MB, 480×360px, 4:3, nido.org_1504483651280.webm)


3575095

Archivo: nido.org_1536807621991.webm (3.94 MB, 640×360px, 16:9, javina.webm)

siempre jajeo con este

3575106

Archivo: nido.org_1536808230470.webm (1.85 MB, 720×404px, 180:101, not my glasses.webm)


3575994

>>3575068
niggas siendo niggas

3575995

>>3575994
posteen mas negros

3576630

Archivo: nido.org_1536900548707.mp4 (10.34 MB, 224×400px, 14:25, Por qué pasan estas cosas - David Montoya Oficial.mp4)


3576643

>>3576630
Que es rico el maricon montoya

3576645

>>3576643
más rico es el que esta leyendo esto

3576652

>>3576645
Ay lorito que es coqueto usted 😳

3576683

>>3575995
totalmente blackeado

y op, al final el negreta se ahogó?

3576689

>>3576683
solo unos rasguños

3576698

Archivo: nido.org_1536906544254.mp4 (854.78 KB, 640×360px, 16:9, 9cf191e0cfd87a72aae011798a2dab186ae520926aa5e1e2997bcb06874f41cf.mp4)


3576731

>>3576698
Jajie con el weón. He estado en situaciones así, pero nunca me han picado.

3576732

>>3576698
murió?

3576733

>>3576732
>lo pican las abejas
>le pican los ojos
>ciego por la hinchazón
>shock anafilactico
>nadie lo asiste
>muere
Sí.

3576735

>>3576732
solo unas picaduras

3577272

Ump

3577285

Archivo: nido.org_1536955557209.png (296.53 KB, 900×640px, 45:32, 147502448689.png)

>>3576698
Es que no podi ser asi de hueon. Ese culiao tiene que haber muerto por el shock anafilactico. Hay gente alérgica que con una pura picada de abeja ya quedan pal gato.

El otro chino que se tiro como de 30 metro al agua, este otro. Mueren de puro ahueonaos.

3577293

>>3577285
tu vas a morir de un shook anal filactico

3577294

Archivo: nido.org_1536955960186.mp4 (548.87 KB, 640×360px, 16:9, video_2018-09-14_17-10-38.mp4)


3577301

>>3577294
pero como no tiene asesores que le digan que haga el baile clásico nomas, que no hay para que hacer ese tipo de weas?

3577302

>>3577294
que chucha esta haciendo

3577306

>>3577294
ERMANO KE WEA

3577307

>>3577302
Su mamón piola.

3577322

>>3577294
Con esto ya me siento pagado al haber gastado mi voto en él

3577335

Archivo: nido.org_1536958951287.jpg (21.72 KB, 480×283px, 480:283, image.jpg)

>>3577294
Me encogí ze~

3577350

>>3577335
mejor metaze~ un dildo dragón por donde le quepa

tengo una duda, eres mujer o maraco? o ámbos?

3577353

>>3577322
>votar por Piñera como presidente por las piñericosas
país culiado bananero

3577356

Archivo: nido.org_1536960117923.jpg (89.77 KB, 960×926px, 480:463, 11218563154.jpg)

>>3577353
>mejor votar por guillelet y convertir al país en chulezuela

3577358

>>3576698
Chino culiado simio

Igual se nota que fué sudoku, pero lo hizo pasar por "estupidez humana" así Lenin no lo juzga cuando llegue al cielo

3577360

Archivo: nido.org_1536960267710.jpg (83.95 KB, 850×1360px, 5:8, __kirisame_marisa_touhou_drawn_by_non_z_art__sample-cb70bfd852a1e13418bf87d1c830…)

>>3577350
Lo segundo, pero igual depende del día.

3577371

>>3577356
>creer que Guillier es socialista y no un DC enmascarado
con ese nivel de política no te da ni para debate de cuarto básico

Guillier iba a ir más o menos por la misma línea que Piñera, si al final eran la misma hueá pero por lo menos Guillier no daba vergüenza ajena. Eres tan simio como el votante chileno promedio que votó por Piñera sólo para rajarles el ano a los zurdos

3577375

>>3577371
Te faltó la imagen de burra azul.

3577378

>>3577375
no soy la burra

3577424

>>3577371
>no es verdadero socialismo, post número 518251285861919619

>>3577378
>no es verdadera burra, post número 61731757157168

3577428

>>3577424
Tu destino es: Illuminati

3577432

Archivo: nido.org_1536964310349.jpg (145.94 KB, 930×1144px, 465:572, Lokito Pro.jpg)

>>3577428
La mememagia es mi aliada.

Estado de los simios que me envidian: Desintegrados.

3577440

>>3577371
ESO NO ERA VERDADERO SOCIALISMO , NUNCA HA SIDO CORRECTAMENTE APLICADO , AHORA SI VA A FUNCIONAR , VERSIÓN 2018 GOLD EDITION

3577450

>>3577440
jajeo y rejajeo con tu esquizofrenia

3577451

Archivo: nido.org_1536965437260.jpg (73.78 KB, 760×501px, 760:501, muro-berlínb-780x514.jpg)


3577454

>>3577451
Pensar que ahora son los cucks de Europa, kek.

3577463

Archivo: nido.org_1536966027423.jpeg (21.8 KB, 377×528px, 377:528, 1562614__safe_artist-colon-lauraselenaantonia_rarity.jpeg)

>>3577451
Curioso que los que más cagaron con la caida del muro fueron los que estaban bajo la administracion del RDA y el glorioso partido socialista unificado, mientras que el otro lado por el RFA lleno de sida, desempleo y hambre, kek.

3577470

Archivo: nido.org_1536966510249.mp4 (404.89 KB, 180×318px, 30:53, Negro empujando camioneta.mp4)


3577475

>>3577463
>fuente: yo

3577480

>>3577470
Jajié suave

3577526

>>3570498
Salsa de esa mierda.

3577536

>>3570589
Llegó el furro/ponymaraco.

3577548

>>3577470
Jajié

3577566

ardor de culo colombiano.webm
(480x480px, 3.76 MB)
congolombiano cogiendo burra.webm
(320x240px, 1.69 MB)
CONGOlombianos.webm
(270x360px, 11.52 MB)


3577588

Archivo: nido.org_1536971447608.jpg (46.96 KB, 540×687px, 180:229, nido.org_1465691767910.jpg)

>>3576698
ONG ONG ONG

3577593

>>3577566
Que es lindo AntofaPASTAgasta

3577598

Archivo: nido.org_1536971687729.jpg (80.47 KB, 1200×600px, 2:1, file_20160419132353-1-1200x600.jpg)


3577600

seifuku shoujo.webm
(400x266px, 4.05 MB)
bici.webm
(320x240px, 3.76 MB)
drop out.webm
(640x360px, 3.91 MB)
Kangoku S.webm
(720x480px, 4.26 MB)


3577606

>>3577566
>kitec de ai ome

3577619

>>3577600
Por la mierda, pixeles de mierda. animéh de mierda, fetiche de mierda

3577662

>>3575068
around niggers NEVER RELAX

3577664

>>3577600
Loro quiero más de la sailor moon, donde lo ubico?

3577668

>>3577664
en la luna

3577670

>>3577664
Parece ser algo de Teruaki Murakami.

3577686

>>3577664
Seifuku Shoujo y sí, es algo de Murakami.

3577697

Archivo: nido.org_1536975907925.webm (12.9 MB, 631×472px, 631:472, Mk.webm)


3577698

>>3577600
el tercero es drop out y el cuarto es kangoku senkan, alguien sabe el nombre del primero? tiene toda la pinta de ser de Murakami

3577701

>>3577697
esa clase similar a la de euphoria si se puede ver.

3577711

Archivo: nido.org_1536976246178.webm (3.88 MB, 1280×852px, 320:213, aspiradora.webm)


3577720

Archivo: nido.org_1536976326998.webm (661.22 KB, 320×224px, 10:7, yahoo.webm)


3577727

Archivo: nido.org_1536976553182.gif (303.35 KB, 480×270px, 16:9, not this one, idiot.gif)


3577731

Archivo: nido.org_1536976628882.webm (3.16 MB, 476×268px, 119:67, amerimutt.webm)


3577738

hispaborto.webm
(224x400px, 5.2 MB)
heroe del patriarcado.webm
(202x360px, 2.63 MB)
guaton pedofilo.webm
(700x800px, 2.37 MB)


3577747

>>3577731
>twitter.webm

3577750

>>3577731
Qué chucha

3577753

Archivo: nido.org_1536977414046.webm (3.8 MB, 640×360px, 16:9, under the sea.webm)


3577755

 Mentally INSANE SJW Screams At a Donald Trump Rally (ScreamyPuff)
>>3577750
Siempre hay un contexto.

3577760

>>3577727
lo siento, en la desesperacion no hice el paso 1

3577762

Archivo: nido.org_1536977544065.webm (1.51 MB, 400×226px, 200:113, kike.webm)


3577764

Archivo: nido.org_1536977736864.webm (1.66 MB, 360×640px, 9:16, tomasin.webm)


3577767

Archivo: nido.org_1536977841116.webm (3.36 MB, 480×360px, 4:3, nyan yui.webm)


3577769

Archivo: nido.org_1536977943969.jpg (22.43 KB, 480×270px, 16:9, 11211856318521.jpg)

>>3577762
Siempre pierdo.

3577776

Archivo: nido.org_1536978048701.webm (3.81 MB, 480×264px, 20:11, the purest form of love.webm)

wat flood

3577781

Archivo: nido.org_1536978194762.webm (5.06 MB, 640×360px, 16:9, python.webm)

Podría estar subiendo webms toda la noche.

3577782

 Rainbow JakkaJan
>>3577767
Superior.

3577790

Archivo: nido.org_1536978616501.webm (2.88 MB, 512×320px, 8:5, 1532021156759.webm)

>>3577781
¿Qué te detiene?

3577792

 JUDGMENT DAY: "The Death of the Left" Berkeley, Ca 15/04/17

3577795

Archivo: nido.org_1536978947105.webm (7.22 MB, 640×360px, 16:9, hentai girl osaka.webm)

>>3577790
Salsa conchatumadre.

3577806

Archivo: nido.org_1536979516499.jpg (8.31 KB, 273×184px, 273:184, salsacia.jpg)


3577852

zoo 1.webm
(960x720px, 7.6 MB)
zoo 2.webm
(480x360px, 3.18 MB)
zoo 3.webm
(640x360px, 2.88 MB)
zoo 5.webm
(640x360px, 653.35 KB)


3577855

Archivo: nido.org_1536981979944.webm (2.96 MB, 853×480px, 853:480, zoo 6.webm)


3577856

Archivo: nido.org_1536982029459.webm (2.13 MB, 640×360px, 16:9, zoo 4.webm)

>>3577855
Listo.

3577857

>>3577855
Cuando te pajeai con esa wea te imaginai que eri un perro o que te esta culeando un perro?

3577858

>>3577790
Esta titan hembra si me gustó.

3577859


3577968

>>3577859
Gracias loro, una mierda su link pero al menos dejaste el nombre. Me lo descargué para correrme una buena paja otro día.

3578000

>>3577857
imagino que me estoy culiando a tu vieja

3578781

Archivo: nido.org_1537048356297.webm (953.33 KB, 352×640px, 11:20, 4e4ac3377aabc370a2d1c7a6de3904ae3e8b884384a9c06fc65f361be1f28b2d.webm)


3578789

>>3578781
Espera…¿por qué?

3578809

>>3578789
una mano al necesitado

3578814

Archivo: nido.org_1537049745935.png (365.28 KB, 1024×576px, 16:9, scared_miku_by_infogirl101-dbbbsqi.png)


3579032

>>3578781
no se si es bondadoso o un enfermo culiao , 10/10 no me dejara dormir.

3579420

>>3577790
Tantos años, hueón.

3579459

Archivo: nido.org_1537071026095.mp4 (1.02 MB, 544×960px, 17:30, ef46408c9df3770284d68169d1497e1a0acf8f1f149cd41c6897da3727a40d50.mp4)


3579477

>>3579459
Me paso algo parecido pero menos mal no vomite.

3579478

>>3579477
te pusiste a tragar guasca?

3579483

>>3579478
No, fue cuando trate de lamerle la zorra a una amiga, el olor y el sabor me dejaron haciendo arcadas y casi vomito. Menos mal estaba oscuro y no me vio (creo).

3579486

Archivo: nido.org_1537072243245.jpg (309.84 KB, 2112×2112px, 1:1, JGgexPI.jpg)

>>3579483
zorras culias asquerosas

3579490

>>3579483
¿tan malo era? siempre pensé que las vaginas tenían buen sabor, quizás eso solo aplica con las lolis y jailbaits que no han tenido relaciones.

3579492

>>3579490
Depende de la higiene de la mina.

3579497

>>3579490
Yo creo que no se habia bañado, ademas era verano y hacia calor. Con el tiempo lo hice de nuevo pero esa vez se la habia depilado y se notaba mas limpia, fue uma delicia.

3579502

>>3579497
guaton mentiroso.

3579504

>>3579497
>y después desperté siendo empalado por un haitiano
te falto contar eso.

3579508

>>3579504
no era tu vieja

3579509

>>3577753
Los atacaron tiburones, les dijeron que no subieran mas de X cantidad o que?

3579512

>>3579508
>me gusta que un haitiano me escupa el ano y después me la meta mientras me apretá los cachetes con sus manos negras
Eso leí.

3580281

>>3579512
>leo lo que quiero que me hagan

3580288

Archivo: nido.org_1537132429427.webm (2.44 MB, 1280×720px, 16:9, abac4fd1ce065086a901a33c4702c2816cfc648642d77685feb179941dba905c.webm)


3580373

Archivo: nido.org_1537135283131.mp4 (1017.88 KB, 176×320px, 11:20, nido.org_1532228580520.mp4)


3580375

>>3580373
¿Cuál es la idea de que te den vuelta las bellosidades intestinales?

3580377

>>3580375
No se pero el negro es cubano

3580381

>>3580375
Si tienes otra forma de estimular la próstata, pues dilo.

3580410

>>3577463
>
Curioso que los que más cagaron con la caida del muro fueron los que estaban bajo la administracion del RDA y el glorioso partido socialista unificado, mientras que el otro lado por el RFA lleno de sida, desempleo y hambre, kek.

Puta loro, yo vivi en alemania del este cuando chico, hasta como los 10 años. Mis viejos volvieron a Chile el 95 y no, no se coma los memes, el RDA era pal pico, la sensacion general de pobreza y abandono era enorme, al pasar al RFA se sentia como si fuera a otro mundo. De hecho chile no se me hace tan penca gracias a las condiciones en las que viviamos alla con mis viejos. Mi vieja todavia llora al acordarse de como la pasabamos.

3580411

>>3580381
Yo me metía pulgas por el ano y me mordian la próstata
Lo mismo hacia en la uretra

3580508

>>3580410
fuente: yo

3580513

Archivo: nido.org_1537140903606.png (10.24 KB, 200×200px, 1:1, images.png)

>>3580410
Cuando no se puede ser más guatón y mentiroso.

3580520

Archivo: nido.org_1537141057710.mp4 (2.89 MB, 640×360px, 16:9, jorge sama.mp4)


3580556

Archivo: nido.org_1537142030514.jpg (79.88 KB, 676×361px, 676:361, nido.org_1470945136303.jpg)

>>3580520
pensar que no volverán las dragon ball burgers

3580563

Archivo: nido.org_1537142279638.jpg (91.29 KB, 643×854px, 643:854, 15032142_1190494141030716_8969623353972358673_n.jpg)

>>3580556
Ni las papitas Acuenta Meido ;_;

3580583

>>3580513
>No hubo exiliados
kek

>>3580508
Y de quien mas quires que sea la fuente sacoehueas? es la historia familiar.

3580589

Archivo: nido.org_1537143267853.jpg (15.19 KB, 550×347px, 550:347, anonimus xd.jpg)

>>3580583
>justo, justo mi familia era exiliada
Tu rajadura anal es: Inmensa

3580594

>>3580589
>no hubo exiliados en chile
Choroy hoy anda mas estupido que de costumbre.

3580597

>>3580594
Dijo nadie, nunca.

>y-ya po, si justo mi familia era exiliada, c-creanme ;_;

Tu nivel de retraso es: Supremo

3580789

Archivo: nido.org_1537148440556.mov (4.87 MB, 276×480px, 23:40, cayendose de poto.mov)


3580801

Archivo: nido.org_1537148667623.jpg (77.64 KB, 540×540px, 1:1, cat pantis.jpg)


3580812

Archivo: nido.org_1537149104256.webm (1.85 MB, 528×528px, 1:1, 1536913958111.webm)


3580814

>>3580597
kek. Yo tengo familia exiliada. Es mucho más común de lo que crees mono ignorante.

3580835

>>3580814
Eso es 1 entre cada 105 chulenos. Sigue siendo bastante raro.

3580843

>>3580835

No es tan raro como para no creerlo.

3581670

La wea

3581733

Archivo: nido.org_1537212829268.webm (3.67 MB, 1511×480px, 1511:480, matematicas.webm)


3581740

Archivo: nido.org_1537213201580.webm (2.47 MB, 1280×720px, 16:9, 1525623080423.webm)


3581761

>>3581740
Sé que estoy viendo sexo heterosexual pero lo encuentro terrible gay.

3581780

Archivo: nido.org_1537215479529.jpeg (18.95 KB, 400×400px, 1:1, L_ExTca2_400x400.jpeg)

>>3581740
no me dejaría penetrar por una chuta con strap on ni aunque estuviera entera rica. La gracia es meterla uno, que te la metan es de maraco.

3581790

>>3577463

>Curioso que los que más cagaron con la caida del muro fueron los que estaban bajo la administracion del RDA y el glorioso partido socialista unificado, mientras que el otro lado por el RFA lleno de sida, desempleo y hambre, kek.


Pero qué está hablando ahora la burrita brainlet y mentirosa.

3581850

Archivo: nido.org_1537218926806.mp4 (1.75 MB, 366×480px, 61:80, 51cd1fb.mp4)


3581868

Archivo: nido.org_1537219668128.mp4 (1.96 MB, 656×360px, 82:45, nido.org_1529177208533.mp4)


3581877

>>3581868
jaj la voluntad para escapar con fé

3581881

>>3581740
No pues, Choroy, esto es lo mismo que se lo ponga un trapo. La que sí vale es ésa de la amazona.
https://www.xvideos.com/video18500939/hot_amazon_position_compilation

3581882

>>3581881
no voy a hacer click en la trampa judía

3581884

>>3581881
hola Bastián.

3581897

Archivo: nido.org_1537221018162.mp4 (572.64 KB, 228×398px, 114:199, 01988bc88494b8e12bec4351c25a866ef87ef47b25be2c15c5061cd120acc57b.mp4)


3582421


3582423

>>3581897
puta, igual lolie

3582425

>>3580789
¿Estará bien?

3583730

Archivo: nido.org_1537328958615.mp4 (4.99 MB, 1280×720px, 16:9, 29f59a1ad515f636229754cdceb67df70c06f11eb5a28b8ceb68360ba61a3602.mp4)


3583736

Archivo: nido.org_1537329114109.mp4 (3.62 MB, 720×1280px, 9:16, 1001255199460093957_1001255199460093957.mp4)


3583742

Archivo: nido.org_1537329204699.webm (1.47 MB, 400×300px, 4:3, 1537015669664.webm)


3583778

Archivo: nido.org_1537330400220.webm (603.82 KB, 352×640px, 11:20, torment1.webm)


3583780

>>3583778
mis figuras de anime ctm

3583805

Archivo: nido.org_1537331810527.mp4 (2.83 MB, 224×400px, 14:25, kebab.mp4)


3583813

>>3583805
Lolie
¿contexto?

3583815

>>3583813
quería kebabs

3583827

>>3583805
En ese minuto toca brutalizarla, lastima que este lleno de weones grabando.

3583867

buen choroye, tiene por ahi un video de un pendejo que se vuela la cabeza de un escopetazo

a lo kul kubein

3583869

Archivo: nido.org_1537338228039.jpg (70.98 KB, 1000×1000px, 1:1, nido.org_1507868043043.jpg)


3583872


3583875

>>3583869
>>3583872

pucha oh ;_;

3583881

Archivo: nido.org_1537339950606.mp4 (4.13 MB, 1280×720px, 16:9, chochi no.mp4)

>>3583875
ya culiao en joy

3583884

>>3583881
lamentablemente ese no es, es uno de un pendejo creo que mexicano que hasta antes de volarse la jeta se despide jajeando

3583921


3583937

>>3583884
>implicando que estos pendejos no están loleando antes de volarse la chochi

3583941

>>3583884
Era un pendejo gringo que transmitía en vivo hacia sus amigos virtuales. Al final del vídeo sale la vieja gritando cuando lo ve desparramado.

El pendejo no pudo ser más brainlet
>puso plásticos para no ensuciar la pieza
>dejó la llave de la pieza afuera pero advirtiendo que no entrarán
<ensucia todo
<la vieja obviamente abre igual y la trauma de por vida
Se suponía que no lo quiso hacer tan traumante para su familia,tremendo haitiano, kek

3583957

Archivo: nido.org_1537365380483.mp4 (5.25 MB, 640×360px, 16:9, In Russia the beat drops you.mp4)


3583958

Archivo: nido.org_1537365458100.webm (1.98 MB, 854×478px, 427:239, 1532623500427.webm)

>>3583884
Este, mi loro?

3583961

Archivo: nido.org_1537365644044.mp4 (572.66 KB, 228×398px, 114:199, VID-20180711-WA0000.mp4)


3583966

Archivo: nido.org_1537366029894.mp4 (2.96 MB, 640×360px, 16:9, DO THE SOYBOY NOW.mp4)


3583967

Archivo: nido.org_1537366101029.mp4 (7.93 MB, 640×360px, 16:9, スパイスパラダイス~カレーメシVer.~ スペシャルコラボムービー90秒.mp4)


3583980

Archivo: nido.org_1537367404619.webm (3.99 MB, 768×432px, 16:9, ratonas.webm)


3584001

>>3583961
Ya lo postearon, aweonao hijoelaperra.

3584009

Archivo: nido.org_1537371865220.webm (6.85 MB, 640×358px, 320:179, mayo no.webm)

>>3583967
>>3583980
los guarde gracias

3584017

>>3583967
>>3583980
Mas por favor.

3584043

Archivo: nido.org_1537374489699.jpg (124.89 KB, 960×697px, 960:697, 26992014_545656672464462_7984167468693248474_n.jpg)

>>3583958
ave hermosa me haces tan feliz

le dejo un putin dieciochero

3584056

Archivo: nido.org_1537375304407.jpg (42.71 KB, 852×441px, 284:147, nido.org_1536873406913.jpg)

>>3583980
>Mouse
>No el Raton siberiano

3584064

>>3584056
Guruuu!

3584081

Archivo: nido.org_1537377382517.webm (3.76 MB, 1280×720px, 16:9, 1532148809129.webm)


3584082

Archivo: nido.org_1537377516398.webm (3.89 MB, 640×360px, 16:9, 1531171466491.webm)


3584085

>>3584043
Pensar que Ricky Lakes destroza académicamente a esos dos.

3584091

>>3584085
Pensar que Lagos tiene la tula de Soros metida hasta el cerebelo.
Bush no cuenta porque no tiene cerebro

3584321

>>3583980
Está como para un ytp. Lástima que me de paja hacer uno.

3584345

>>3583958
>>3583941
>al final del vídeo sale la vieja gritando cuando lo ve desparramado
guatón mentiroso

3584352

>>3584345
Pero si choroy subio el corto del 4 sin sonido.

3584463

Archivo: nido.org_1537391793718.mp4 (5.67 MB, 270×480px, 9:16, ccc50ec6110880af7e4a3f0d40fddfd47f68cdb9e21091686b7e75771bda4c26.mp4)


3585136

Archivo: nido.org_1537425195927.webm (6.08 MB, 400×400px, 1:1, c3a6bba8a794a9a8eff8439ec99676aae3ff5e06c88957d1bc47d28683834789.webm)

que mierda????????

3585140

>>3585136
QUÉ MIERDA

3585141

 Risa del señor Burns - Los Simpson
>>3585136
Ah, reí mucho.
Voy a buscar la noticia.

3585142


3585143

Archivo: nido.org_1537425957731.mp4 (935.31 KB, 1280×720px, 16:9, a56161d89d23f6afcae6a025dd419942777fd9acbb87f10844f0883078c3c8da.mp4)

>>3585141
es fake pero lo podemos hacer real

3585144

>>3585136
me tinca fake loco.

3585146

Archivo: nido.org_1537426130405.mp4 (11.34 MB, 352×640px, 11:20, nido.org_1531866052114.mp4)


3585152


3585179

>>3577762
pupilo de Lavanderos

3585180

>>3585143
verdaderamente perturbador, loro.

3585183

>>3585143
loro no tiene un video parecido pero con una guagua deforme?

3585184


3585303


3585466

>>3577738
segundo vídeo,
>se pone a llorar JJAAAAAAAAAAAAAAAAAAAA

3585472

>>3577738
Me acordé que mi prima chica habla como mexicana por los yutuber, solo pienso que debe ser una fase pero me irritó. ¿Hay vuelta atrás o ya cagó?

3585479

Archivo: nido.org_1537468819583.png (410.39 KB, 554×693px, 554:693, Screenshot_1.png)

>>3577738
jajié con el tercero

3585714

>>3585472
dile que no mame weeeeeeeeeeeeeeeeeeeeeeeeeey

3585716

>>3585472
Quedate piola pinche normie.

3585729

>>3585479
hay una historia detrás de este vídeo?

3585732

>>3585479
QUE ALGÚN FANARTERO HAGA A CHOROYA/CHOROY EN ESTA FOTO

3585734

>>3585729
el guaton construyo ese robot para competir en el smash

3585740

>>3585729
Justin Wong, un jugador profesional de Street Fighter.
Fue cuando iba a salir el Pokken e invitaron a varios jugadores de FGs.

3585794

Archivo: nido.org_1537478458167.jpg (113.82 KB, 360×360px, 1:1, justin-wong-1.jpg)

>>3585740
Pensé que era inventado pero veo que es verdad, qué mierda. Tremendo pedro

3585796

Archivo: nido.org_1537478510461.jpg (502.97 KB, 1400×1433px, 1400:1433, 1471174241711.jpg)

>>3585794
Es la sobrina, enfermo culiao.

3585823

>>3585796
Dibujo culiao me cagué.

3585831

>>3585794
Dudo mucho que el hueón sea Pedro en todo caso, solo es medio inepto para relacionarse físicamente, bueno, desde que adoptó su faceta de ser el hueón buenito de la FGC.

3585834

>>3585794
¿Y ese rare Kumacerdo?

3585951

Archivo: nido.org_1537482510003.png (401.84 KB, 1366×768px, 683:384, 66666666.png)

>>3585136
Conchetumare perdí como simio en esa parte y me recordó a algo

>ser io

>en colegio simio
>compañero weon
>nadie lo pesca por que es mas pesado que la chucha y sapo el maricon
>un día nos sepea por x cosa
>el inspector general casi nos caga a palo y nos suspendió
>planear venganza
>paseándome en mi casa pensando alguna forma para vengarme de ese pendejo culiao
>hace días mi hermano mayor andaba con problemas para cagar y mi kashera le compro un laxante
>estuvo días cagando sin parar
>laxante basadisimo
>pescarlo y hacer un queque chico siempre me gusto la cocina de chico
>me quedo linda la wea
>llevarlo al colegio
>primer recreo
>les cuento a los simios lo que hice y el plan
>jajean como chimpancés
>lo llaman
>compañero sapo llega
<QUERI QUE-QUE??
>compañero sapo no pudo resistirse a lo deseable que se veía el queque
>se lo come
>JAJEARRR
>no decimos nada, el weon igual desconfía
>se va
>en clases
>en ese momento pensaba que la wea no había funcionado, quizás al mezclar con el queque cago algún compuesto del laxante
>compañero sapo se ve medio mal
<oye parece que funciono la wea, mírenlo
>se retuerce un poco
>quedarse piola
>compañero sapo le dirige la voz al pobresor mas pesado del establecimiento y pedofilo por que tocaba a las compañeras kek
<pr-profe pu-puedo ir al baño?
>espérese hasta el recreo
<p-profe de verdad tengo que ir al baño
>TE DIJE QUE NO,DÉJAME HACER LA CLASE
>salto y digo
<OYE DEJA QUE EL PROFE HAGA LA CLASE, SI TODOS SABEMOS QUE NO SE PUEDE IR AL BAÑO EN CLASES weon chanta, si nunca tomaba atención en clases y salia con esa. top kek
>lo veo sufrir y sudar como caballo
> win win conchetumare
>después de un rato "su amiga" y compañera de banco se empieza a quejar
<PROFE ESTA PASADO A CACA
>empezamos a tirar carbón
<UUUH SI ESTA PASAO A CACA
<QUIEN SE CAGO??
>jajeaaarrr me siento en otra dimensión, pase el nivel de "simples bromas"
>compañero sapo solo llora y trata de pasar piola
>segundos
<EL PEREZ no es su apellido pero dejemoslo asi SE CAGOOOOO
<OOH WEON COCHINO
>resulta que el weon no se cago solo un poco, si no que se cago entero
>tan así que la mierda le llegaba a los tobillos
>TOP KEK CONCHETUMAREEEE
>evacuan la sala
>suben inspectores
>ver como llora
>saco mi celular para grabar ese preciado momento
>INSPECTORA FALTA DE PICO ME QUITA DE LA NADA EL LADRILLO NOKIA XPRESS MUSIC
>vieja culia igual mi wea con cuea grababa kek
>nunca había sentido un olor a mierda tan fuerte
>la sala no se pudo ocupar en una semana
>como se imaginaran el weon nos sapeo
>negamos todo, no habían pruebas
>igual me suspendieron por que tenia 3 hojas de anotaciones kek
>el sapo culiao se tuvo que cambiar de colegio

Creo que ese fue el mejor día de mi vida .

3585955

>>3585951
Ay pobre perez.

3585981

>>3585951
mentiroso conchatumadre

3585991

>>3585951
Hermoso choroy. Cuál era el laxante en cuestión?

3585992

>>3585951
>3 hojas de anotaciones
se huele el inacap

3586010

Archivo: nido.org_1537484835974.jpg (57.22 KB, 590×340px, 59:34, tom-araya-barba-web-590x340.jpg)


3586012

>>3585992
PEREZ CULIAO TODAVÍA ESTÁS PASADO A MIERDA

3586017

Archivo: nido.org_1537484976784.webm (794.49 KB, 1792×960px, 28:15, 1534881459412.webm)


3586019

Archivo: nido.org_1537485083306.webm (3.96 MB, 752×480px, 47:30, 1536934532593.webm)


3586056

>>3585991
No me acuerdo han pasado demasiados años, esta wea paso como en el 2010, lo único que me recuerdo, es que el laxante le costo casi 10 lucas a mi mamá y la gloriosa cagadera de mi compañero, esas cosas nunca se olvidan.
>>3585992
Siempre fui un remolino culiao y me anotaban por todo >>3586010
Tengo varias historias de los colegios simios en los que estuve, vi como compañeras se dejaban tocar y hasta como unos compañeros intentaron violar tener sexo a una compañera que se las daba de maraca.

3586083


3586471

Archivo: nido.org_1537494619224.mp4 (2.86 MB, 640×360px, 16:9, criss_656303.mp4)


3586478

>>3586471
Ese aguante para recibir combos sólo lo había visto en Jarita.

3586486

Archivo: nido.org_1537494964093.gif (1.2 MB, 250×231px, 250:231, laughs.gif)

>>3586019
Jajie.

Hubiese quedado mejor con la Horst Wiesel Lied que con la Königgrätzer marsch.

3586521


3586529

 Te vamo a volar la raja Soledad Onetto (REMIX)

3586533

>>3586478
Quizás pega como marica, igual que yo que soy un debilucho.
>cuarto medio
>ser el más piola del curso
>me buscan pelea
<alv hay que hacerse hombre
>doy un combo
>el otro no siente nada
>se caga de risa
>me dice que me siente nomás
>se va riendo
A 9 años de eso aún me da vergüenza recordarlo.

3586535

Archivo: nido.org_1537496104916.png (39.37 KB, 553×759px, 553:759, 130657054349.png)

>>3586533
>27 años
<nesting

3586537

>>3586533
>alv
Eden queda más allá, conchetumadre.

3586541

>>3586533
>alv
Ban.

3586551

Archivo: nido.org_1537496657621.mp4 (448.06 KB, 400×224px, 25:14, pajarosqls.mp4)


3586563


3586572

>>3586535
Aún soy un perdedor socialmente.
>>3586537
>>3586541
Son palabras que se me pegaron de mi chuta infante.

3586681

>>3586533
Kek, siempre soñaba que me agarraba a pelea y mis golpes salían sin fuerza.

3586707

>>3586056
Cuenta la historia de la compañera maraca choroy, el pueblo lo pide

3586715

>>3586707
>no estudio en colegio público donde habían weonas así por montón.

3586751

Archivo: nido.org_1537504749580.jpg (25.98 KB, 173×250px, 173:250, ss (2018-08-16 at 10.55.54).jpg)

>>3586715
>serio
>compañera maraca
<Choroy es una roca
>nunca nada

3587768

Archivo: nido.org_1537579061056.mp4 (2.29 MB, 1280×720px, 16:9, 9e2f2ca63669eeb55189544bd14a0a44f00ee09e8fce74300725d1a8135b3b2e.mp4)


3588567

>>3587768
>cabecea un Uber

3588569

Archivo: nido.org_1537642187748.mp4 (1.27 MB, 640×360px, 16:9, alexandra gaier (@acidjazzsinger) • Fotos y vídeos de Instagram.mp4)


3588581

Archivo: nido.org_1537643142672.mp4 (749.85 KB, 640×640px, 1:1, 34034731_118791165622219_6629191737276251116_n.mp4)


3588613

>>3588581
salsa please

3588618

>>3588613
Dice Bunny Ayumi al costado Choroy, andamos malos para lurkear

3588670

Archivo: nido.org_1537646612824.webm (2.8 MB, 1280×720px, 16:9, 1537628273408.webm)


3589088

Archivo: nido.org_1537659404326.webm (578.24 KB, 460×348px, 115:87, a3bec3a4105ea6e7376a8fc41a90281287c52149c75b4d00c1f066bdb1274e8a.webm)


3589104

>>3589088
El blooper debió salir super caro.

3589321

>>3575090
me encanta como le gritan al del auto rojo, como si el tuviera la culpa que el sopa du macaco se le cruzara>>3575090

3590200

Archivo: nido.org_1537714958223.webm (8.34 MB, 480×270px, 16:9, d891710414af722b15df0d71f57afa3c6ca515922553210ae75054e93f9fc13c.webm)


3591971

>>3590200
jajié

3591986

Archivo: nido.org_1537766415835.webm (1.28 MB, 406×720px, 203:360, 1537764223997.webm)


3592018

>>3591986
no entendi

3592023

>>3592018
yo tampoco

3592119

Archivo: nido.org_1537776319422.jpg (213.35 KB, 1024×768px, 4:3, image.jpg)

>>3586533
>alv

Huelo un zoomer aquí.

3592475

>>3590200
jajié

3592486

Archivo: nido.org_1537813444316.mp4 (7.98 MB, 352×640px, 11:20, cultura1.mp4)


3592492

Archivo: nido.org_1537813918698.jpg (80.16 KB, 1280×720px, 16:9, descarga (1).jpg)

>>3592486
Literalmente, pelea a muerte con cuchillos.

3592500

 Duelo a muerte con cuchillos
>>3592492
>pelea
<no duelo
Lo haces mal loro.

3592504

>>3592486
1 VS 1 SIN POLERA

3592518

Archivo: nido.org_1537815583453.webm (2.13 MB, 900×506px, 450:253, fQGo.webm)


3592773

>>3592486
más pollo el verde

3592785

>>3592518
conchetumadre, me esta riendo hasta la última parte, porque no pusieron una mina mejor.

3592787

>>3592486
negros siendo negros.

3592789

>>3592486
Nuestros hermanitos latinos.

<3

3592797

>>3592486
lolie con el ataque final justo en el cráneo.

3592804

>>3592785
y cual es el chiste?

3592807

>>3592804
que uno de los weones le empieza a chucpar el pico al otro.

3593164

Archivo: nido.org_1537840002149.webm (3.9 MB, 852×480px, 71:40, 1537375318590.webm)


3593302

Archivo: nido.org_1537843426602.webm (1.53 MB, 856×480px, 107:60, 4U47.webm)


3593318

Archivo: nido.org_1537843787807.jpg (93.06 KB, 768×1024px, 3:4, coja abierta.jpg)


3593427

>>3593164
Alerta, extremadamente jajiante.

3593542

Archivo: nido.org_1537855199375.jpg (34.5 KB, 413×395px, 413:395, 138645895597.jpg)

>>3593164
Reí pulento.

3593544

Archivo: nido.org_1537855477604.webm (3.63 MB, 950×534px, 475:267, 1537586992361.webm)


3593546

>>3593544
En realidad las japonesitas hablan como yakuza con voz agurdientoosa. XD

3593548

Archivo: nido.org_1537855726658.jpg (117.36 KB, 960×540px, 16:9, 138353057164.jpg)

>>3593544
Mi sueño es irme a vivir a japón y culearme la mayor cantidad de asiáticas con mi "belleza exótica"

3593550

>>3593548
Vas como avión.

3594367

Archivo: nido.org_1537915422746.webm (1.02 MB, 768×436px, 192:109, 1c61ab561fd645354f8d27c78aa8ad0ac33479a5f6c39ae74fd77ff4f2d3eca6.webm)


3594451

>>3593548
gaijin ql delirante xd

3594553

>>3591986
No entendí

3594562

>>3594367
Puta que es brígido Federico.

3594563

>>3594562
anda bélico Geppetto

3594570

Archivo: nido.org_1537922308232.webm (1.42 MB, 640×360px, 16:9, Hardcore Henry.webm)


3594609

>>3581733
Como que me hipnotizó ese video, necesito mas información choroy

3594621

>>3581733
más fome porfa

3594679

>>3594553
Por lo que escuche, la mina dice algo como "Nicolas" y el hueon le dice "ah?" donde la mina responde: "ese es tu nombre ¿cierto?"

3594680

>>3577463
Jajie mal.
El negacionismo histórico y sesgo del burrero es lo más simio que he visto.
Básicamente, todas las fuentes que justifican sus puntos son 100% veridicas, y las que no, siempre son cuestionables, kek.

3594685

>>3594570
Dice "the gayest jacket"?

3594791

 Angry German Miku Hatsune
>degrees

3594801

Archivo: nido.org_1537928830443.jpg (118.9 KB, 695×642px, 695:642, joda.jpg)

QUIERO JAJEAR CONCHETUMARE SUBAN WEAS CON LAS QUE PUEDA PERDER COMO SIMIO AVES CULIAS

3594809

Archivo: nido.org_1537928947346.mp4 (288.82 KB, 360×360px, 1:1, fire.mp4)


3594814

Archivo: nido.org_1537929023968.webm (1.51 MB, 480×600px, 4:5, choroy promedio.webm)


3594818

Archivo: nido.org_1537929059344.mov (10.94 MB, 264×480px, 11:20, 9E156369-1F8D-4CFE-A73F-02E7BB04BA63.MOV)


3594819

>>3594809
La hueona tomasin, kek

3594820

>>3594814
Jajie suave, nada mas.

3594824

>>3594814
kek igual lolie

3594826


3594839

Archivo: nido.org_1537929662819.webm (1.85 MB, 368×640px, 23:40, 1537639020869.webm)


3594843

>>3594839
¿Que chucha acabo de ver?

3594850

Archivo: nido.org_1537929982982.mov (3.31 MB, 480×480px, 1:1, 514BD32A-C22A-4399-83BF-C0D72F4CC133.MOV)


3594851

>>3594843
progresismo

3594856

>>3594843
Un mundo sin hitler

3594859

Archivo: nido.org_1537930282686.webm (807.67 KB, 400×224px, 25:14, infierno.webm)


3594876

Archivo: nido.org_1537930823930.jpg (5.48 KB, 250×251px, 250:251, A38D7.jpg)


3594877

>>3594850
señor jesucristo la grima…

3594885

Archivo: nido.org_1537931169499.webm (2.77 MB, 478×360px, 239:180, 5S91.webm)


3594951

>>3594885
Chile 2027

3594964

>>3594885
yo juraba que el negro le iba a volar la cabeza al soya por provocativo

3594965

>>3594885
>llevate la caja conchatumadre

3594998

Archivo: nido.org_1537933771842.mov (1.17 MB, 568×320px, 71:40, E812DC71-EE7C-4CFD-8281-9FCF7ABB476A.MOV)


3595000

Archivo: nido.org_1537933782505.webm (7.32 MB, 1280×720px, 16:9, nido.org_1509587344665.webm)


3595033


3596357

bump para mas jajeo.

3596363

Archivo: nido.org_1538009708712.mp4 (2.99 MB, 640×360px, 16:9, THOT SLAYER.mp4)


3596465

Archivo: nido.org_1538011855750.webm (3.98 MB, 533×300px, 533:300, MAMERTOS VINE.webm)


3596566

Archivo: nido.org_1538013991033.mp4 (24.35 MB, 1920×1080px, 16:9, Horror prank with compressed air pipe costs life of factory worker.mp4)

>cuando inflas globos con el poto y luego mueres

3596581

>>3596566
la broma acecina xdxdxd

3596589

Archivo: nido.org_1538014590882.png (87.45 KB, 375×413px, 375:413, 1537804216131.png)

>>3596566
¿Alguien me explica como alguien puede morir de una turbo chupá de poto?

3596592

Archivo: nido.org_1538014658361.jpg (41.85 KB, 642×725px, 642:725, 1528094465686.jpg)

>>3596589
>compressed air pipe
<chupá

3596598

>>3596589
http://www.theclinic.cl/2018/05/11/cuento-chuck-palahniuk-tripas/
Resumen del cuento: un pendejo experimentando nuevas pajas acerca el culo al filtro de la piscina.

3596661

Archivo: nido.org_1538016194369.jpg (262.65 KB, 740×628px, 185:157, 841-635.jpg)

>>3596465
Se me rajo el ano con el pobresor.

3596670

 PANTS.swf
Ni siquiera es su forma final

3596819

>>3594964
A vo te van a volar la cabeza por saco hueá.

3596841

Archivo: nido.org_1538021329698.mp4 (3.67 MB, 720×1280px, 9:16, VID-20180926-WA0017.mp4)


3596843

>>3596841
Hay que funarla

3596844

>>3596841
Yo al medio.

3596849

>>3596841
jaja ese vomitado que es como papilla es el más penca

3596855

>>3596841
CATACATACATACATACATACATA

3596857

>>3596841
a las mujeres no les da vergüenza que les pase esa wea?

3596859


3596861

>>3596855
>>3596841
CATACATACATACATACATACATA

3596862

>>3596849
No dan ni ganas de pararse al otro día con esa cagá encima.

3596867

>>3596857
No loro, se cagan de la risa.

3596878

>>3596841
>dejar que te guitreen encima
NOOOOOOOOOOOOOOOOO

3596881

>>3596841
YOU ARE ALL VOMITED AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

3596884

>>3596841
Que linda la rucia que no hizo show por el vómito, me causó ternura. Por muy amigo que sea, me hacen esa weá y se come sendas patás en el hocico.

3596886

>>3596841
vi el webm y me llego un olor a pisco vomitado kek

3596898

Archivo: nido.org_1538023002919.webm (2.51 MB, 368×640px, 23:40, VaIT.webm)


3596901

>>3596898
Loco culiao.

3596907

>>3596901
BZZZZZZZZZZZZZZ GUEONAAAA SIONOOOO WEON LOCOO BzzZZZZZZZZzzzzzzzzzzzZZ

Vuelve a cancerbook, amariconao.

3596925

nido.org_1526344939324.webm
(1280x718px, 2.65 MB)
aspiradora.webm
(1280x852px, 3.88 MB)

>>3596901
¿y ellos?

3596933

>>3596898
To what end

3596938

>>3596898
Conchetumadre pensé que era el único que hacia esto, me siento aliviado.

3596954

>>3596938
Lolié suave
Tu destino es: Dibujante de comics

3596969

Archivo: nido.org_1538026137145.mp4 (1.09 MB, 406×720px, 203:360, ay.mp4)


3597028

>>3594885
momentos autistas do messi

3597045

>>3590200
[gold]Pelea de mechas[/gold]

3597577

Archivo: nido.org_1538067033158.webm (1.38 MB, 534×300px, 89:50, ETnI.webm)


3597584

Archivo: nido.org_1538067286964.webm (2.71 MB, 640×800px, 4:5, yeeeeNOOOOOOOOOOOOOOOOOOO.webm)

>hilo de hace 3 mil semanas
<aun nadie postea el video mas ultrajajeante jamas posteado

3597602

Archivo: nido.org_1538067772120.webm (1.89 MB, 640×360px, 16:9, acero.webm)


3597618

>>3597584
Oh la wea wena totalmente hilarante.

3597636

>>3597602
Porqué las mujeres reclaman tanto que no tienen las mismas oportunidades de trabajo que los hombres pero se niegan rotundamente para este tipo de trabajos no calificados?

3597647

>>3597636
Porque son mujeres.

3597661

>>3597584

qué mierda fue eso

3597665

>>3597636
Hay que ser retrasado para meterse en uno de esos trabajos donde puedes morir como en el gif.
Reclaman que no pueden llegar a estar en cargos importantes solo por ser mujeres, ni hablar de los sueldos inferiores. Infórmese.

3597682

>>3597636

el feminismo es la cara dura, el nacisismo y estar ensímismada en ella misma.

3597707

 Documental sobre la inexistente brecha salarial y la "discriminación" sexista en los trabajos
>>3597665
>>3597636

Las feministas solo quieren puestos de trabajo fáciles con sueldos millonarios solo por ser mujer y que los hombres hagan los trabajos riesgosos.

3597866

Archivo: nido.org_1538074673707.mp4 (8.87 MB, 640×352px, 20:11, VID-20180927-WA0001.mp4)


3597887

 BRONCE V GOLPEA A SUS PADRES Y REVELA INFORMACIÓN PERSONAL

3597899

>>3597866
conchetumadre como no previeron eso

3597904

>>3597866
peruanos culiaos tenían que ser XD

3597954

Archivo: nido.org_1538076613592.mp4 (11.88 MB, 852×480px, 71:40, nido.org_1520902552835.mp4)


3598052

Archivo: nido.org_1538080499693.webm (4.07 MB, 224×400px, 14:25, 87HT.webm)


3598096

 Sullana - soldados peruanos se quemaron en pleno desfile militar
>>3597899
Y falto el soldado con poder para realizar combustión espontanea

3598101

>>3597866
Lo cómico es como hay una voz que le echa flores a Perú de fondo.

3598105

8ae4d8f4a84bf1bc9c464e035ce2241e.webm
(1080x536px, 8.32 MB)
b8079303af4a769a887b2eb06b9c48c3.webm
(1280x540px, 9.3 MB)
c013b699771084ece21ef121f247b1ef.webm
(1436x808px, 11.67 MB)


3598110

2c6ed9d01612840fe5b09fb6e0777136.webm
(1920x1080px, 1.21 MB)
b543d8db5151e2aa84bbd7704ddb0c05.webm
(1280x720px, 254.3 KB)
3c29aad239d32725224997c7ab4c7627.webm
(1280x720px, 467.24 KB)
0357ca7f6ff563368d5cfb1a901fe931.webm
(1280x720px, 6.68 MB)


3598114

>>3598105
>>3598110
los mismo cada vez? actualizate pobre hueon

3598117

6e0fce41a53d49fb0cd4e4a61e12c34a.webm
(1280x720px, 8.28 MB)
6e0fce41a53d49fb0cd4e4a61e12c34a.webm
(1280x720px, 8.28 MB)
ed8471c008911188959a39fb14b30956.webm
(1920x1080px, 4.86 MB)
efbddd5fabbabf061d876ef5ecf31abd.webm
(1280x720px, 920.59 KB)


3598134

19e2c0cac1a8cc941f9cb297897b2642.webm
(1448x1080px, 1.6 MB)
115edd88f7d3a714f724a323fd55b13c.webm
(1280x720px, 9.67 MB)
79fcf61191d054e210637963ca571441.webm
(1280x720px, 9.41 MB)


3598139

a5fc1d9c3e96b59eadbbf262d8e77d66.webm
(1280x720px, 6.13 MB)
55f0ac97acc22f1c03a8db6f3d8d5d78.webm
(1280x720px, 2.86 MB)
ab7a99f0aa61b36b32406115e3db5844.mp4
(720x1280px, 7.74 MB)
64aa2d0a3b2ae119ece17d8f395b7042.webm
(1920x1080px, 1.35 MB)
2e1775fc35dcfd287dd055ea96a72131.mp4
(1280x720px, 646.36 KB)


3598148

Archivo: nido.org_1538083897112.mp4 (15.14 MB, 1280×720px, 16:9, 625586371a49d78dcc1132895dc55b1a.mp4)


3598151

Archivo: nido.org_1538083964487.mp4 (16.33 MB, 1920×1080px, 16:9, 79327a5bc1f82ded082afaa3d85118f0.mp4)


3598156

>>3598114
ni siquiera son jajiantes sus mugres

pajero ql

3598157

811efce9279afd79ca4eab457820b299.mp4
(1920x1080px, 14.78 MB)
d4d7638089b4d5bded6cd308d6302d85.webm
(1280x720px, 4.07 MB)

>>3598151

3598159

UMAS DELICIAS

3598162

07369d5acc1896d6a5f8f629f2f25b37.mp4
(1920x1080px, 7.4 MB)
82d74c363e1da1753d24e4f75ec1335f.webm
(1280x720px, 9.18 MB)
1be37abffe6bd81bdee86aab925527ca.webm
(1920x1080px, 1.17 MB)

>>3598157

3598166

>>3598156
¿Para que mierda comentas pendejín y la conchetumadre? Parece que no estás en el lugar indicado.

3598168

5610483fc4a6535ccdf06bd7ece6a54a.webm
(1920x1080px, 8.51 MB)
7381b27305c580de54a8cee5f7e95727.webm
(1920x1080px, 5.01 MB)
727fd5d5e3954b662b16147f6b751357.webm
(1920x1088px, 2.63 MB)

>>3598162

3598172

6b160ba346506e08509ef9d65a65800f.webm
(1920x1080px, 9.88 MB)
89316567b2ba390689173684bb1411a7.webm
(1280x720px, 9.79 MB)

>>3598168

3598173

29cff46628b624b5224fa1d7f2b51ac0.webm
(392x150px, 12.62 KB)
e9bf9623211a867bea34ebd62160ef2f.webm
(1920x1080px, 10.86 MB)
2bd030312119e7b23cb9f40a17a9e22f.webm
(1920x1080px, 1.74 MB)
c657edd052a7090e688292e0503ae53d.webm
(1920x1080px, 6.04 MB)

>>3598172

3598176

>>3598168
>>3598172
te equivocaste de board pajero ctm

3598178

>>3598176
DÉJALO, DÉJALO COMO ESTÁ.

3598179

8fb23e758d4066f9175d1fe35b85e39a.webm
(640x500px, 107.67 KB)
5a9764bbeae35d0e78ffeaac93bb365b.webm
(1280x720px, 4.1 MB)
379f9fca3659232ae8063319d76f99f9.webm
(1280x720px, 540.11 KB)
c4af49b7ba442273787f4024a2936e02.mp4
(1280x800px, 2.34 MB)

>>3598173

3598181

Archivo: nido.org_1538084776797.webm (24.4 MB, 1280×720px, 16:9, b7b6f020e1817f04e8d3901682d42f26.webm)


3598185

7b1d3101f58eb14d33089fab2ba7be32.mp4
(1280x720px, 2.79 MB)
c29b5d1c68c6fd29da5e66a13c1d8f32.mp4
(800x1280px, 1.08 MB)
674f94b11c36405893f38351b9762a41.mp4
(720x1280px, 1.7 MB)
3210907c471f120f7eeb487adbeea926.mp4
(720x1280px, 3.34 MB)
6b39737d1d35565d19cb9974e35ac8df.mp4
(1280x720px, 1.15 MB)

>>3598181

3598187

132734e90da13fcd2b797aadb39c03c9.mp4
(720x1280px, 1.72 MB)
2fc7bee5da9e5260f1f1fb99cced75a2.mp4
(720x1280px, 1.32 MB)
47f87de82f02fd7cdc866ebc4088fad4.webm
(1706x720px, 1.46 MB)
734da15db608592ba24c24afd53bbf50.webm
(1280x720px, 1.28 MB)
93812a104fa66991af67029e10fb6da0.webm
(1440x810px, 1.91 MB)

>>3598185

3598190

f342095cf90768858959ed378c955a93.webm
(1920x1080px, 14.05 MB)
5991e064b105586377792de9c58229f7.webm
(650x650px, 296.39 KB)

>>3598187

3598192

f6d6200da2461566abff306988c53e53.webm
(1280x720px, 2.59 MB)
aaa851f1e3ad0663185b1949cbc6f005.webm
(1280x720px, 2.82 MB)
9ebf78b4ddc9dd1d669c43eb06d06641.webm
(1920x1080px, 9.56 MB)
8e142ae18501d1b93ae42b2150e457ab.webm
(1920x1080px, 6.16 MB)

>>3598190

3598195

este hilo mejoró espectacularmente.

3598198

491f3cca68c807dcb44ffa272563b85b.webm
(1920x1080px, 9.7 MB)
267cbfe148e375f102b04ca0d3fba24d.webm
(1280x720px, 232.87 KB)
d10c3d82b67d751a5813b193f6dbfa30.webm
(1280x1132px, 6.18 MB)

>>3598192

3598200

Archivo: nido.org_1538085356836.webm (9.53 MB, 1920×1080px, 16:9, 1586ed0e56cd3e7cbe4dd3bf8eb47e6d.webm)


3598250

Ya no jajeo.

3598255

>>3598250
yo me pajeo.

3598257

>>3598250

masturveo

3598288

9da1c89875644395b94ee339aee4dbea.jpeg
(924x1648px, 247.93 KB)
2afe64175d0536d1095fa25b1c2debeb.webm
(1280x720px, 290.39 KB)
50bc425cce0f64704912ece5df745e5d.webm
(1280x720px, 277.5 KB)
86592fe1e0a9c59a8567c2e60fb25de6.webm
(1280x720px, 278.2 KB)
f055b522cd5801478723f198e4a2eb67.webm
(1280x720px, 613.96 KB)

>>3598200
Estos 2 no los pude subir porque son muy pesados, espero les gusten.

No podré volver a subir en un tiempo, por cosas de trabajo, disfrútenlo.


https://mega.nz/#!baoDyYCT!JnnoNSOHi6R7nQFMlqYqhorSBqKDJZ-DIWg52w0uLLs


https://mega.nz/#!zOxV3QoI!rxL5Z14zYo7WHwdL3m7GV7H_e5Eyd19ZZ853CC1bwMo

3598350

>>3598288
Eso fue todo? ya podemos seguir con los videos jajiantes?

3598356

>>3598288
Gracias por la caca .

3598390

Archivo: nido.org_1538092009876.webm (402.6 KB, 480×480px, 1:1, UF7Z.webm)


3598402

>>3598390
>monopatin en la ingle

3598413

Archivo: nido.org_1538092395984.png (322.04 KB, 416×431px, 416:431, 707.png)

>>3598350
>>3598356
Puta que me dan risa los pendejines amurraos porque subieron weas que no les gustan.

Recordatorio que los edgys siempre son los mas maricones.

3599026

Archivo: nido.org_1538113970452.jpg (8.02 KB, 229×244px, 229:244, 448998245493.jpg)

Llegó el autista del porno sfm a cagar el hilo.

3599042

Archivo: nido.org_1538114981362.gif (985.96 KB, 300×196px, 75:49, 1425487070250.gif)

>>3596969

loleo y me pregunto si la electricidad cura la homosexualidad

3599047

Archivo: nido.org_1538115143865.webm (1.5 MB, 640×360px, 16:9, nido.org_1484513289504.webm)


3599048

Archivo: nido.org_1538115169549.webm (3.75 MB, 426×240px, 71:40, woke niggas.webm)


3599049

>>3599042
te deja más bzzzzzzzzzzzzzzzzzz

3599052

>>3599048
si decimos algo parecido de los negros seríamos racistas

3599054

Archivo: nido.org_1538115676643.webm (3.08 MB, 848×480px, 53:30, tufo.webm)


3599055

>>3599054
Siempre pierdo con esa mierda.

3599062

Archivo: nido.org_1538116653967.webm (1.03 MB, 480×480px, 1:1, 1408936626452.webm)


3599067

Archivo: nido.org_1538117009964.webm (1.29 MB, 360×360px, 1:1, perrituu.webm)


3599072

>>3599054
TODAS PUTAS

3599075

>>3599067
No hay una versión más larga?

3599076


3599532

Bump

3599593

Archivo: nido.org_1538154705203.webm (2.47 MB, 294×240px, 49:40, nido.org_1530309259514.webm)


3599610

Archivo: nido.org_1538154938898.mp4 (367.06 KB, 400×226px, 200:113, maradona.mp4)


3599652

Archivo: nido.org_1538156538366.webm (934.33 KB, 480×600px, 4:5, aATo.webm)


3599682

>>3599610
Le ponen color los culiaos. Estoy seguro que hasta el pendejo se rió

3599688

>>3599652
En China censuraron a Peppa Pig

3599852

Archivo: nido.org_1538163142718.mp4 (4.97 MB, 640×360px, 16:9, how TLJ should have ended.mp4)


3599935

>>3599852
Lo triste de ese edit es que tiene tanto mas sentido que el 90% de esa película.

3600368

Archivo: nido.org_1538185229021.mp4 (1.06 MB, 640×360px, 16:9, b0239a495bbbffa709d484b28575561b94ceb7074ccddb88060e961946d3fd30.mp4)


3600375

Archivo: nido.org_1538185343558.jpg (12.05 KB, 480×508px, 120:127, 1517974883171.jpg)


3600377

Archivo: nido.org_1538185436740.jpg (718.12 KB, 3200×3200px, 1:1, 1486614729501.jpg)


3600392

Archivo: nido.org_1538185894313.jpeg (2.57 MB, 6064×6072px, 758:759, Trump.jpeg)


3600398

>>3600368
no entnendí
estaba electrificada?

3600400

>>3600398
Así es.

3600417

Archivo: nido.org_1538187005972.jpg (13.05 KB, 443×332px, 443:332, 25990538_10213407918130106_1469484452_n.jpg)

>>3600368
adoro los finales felices !

3600419

Archivo: nido.org_1538187059659.webm (2.35 MB, 640×360px, 16:9, How To Win An Argument In 2018.webm)


3600423

Archivo: nido.org_1538187154886.jpg (5.26 KB, 242×208px, 121:104, nido.org_1461119749212_n.jpg)


3600437

>>3599935
oh weón dejar la wea ahí sin explicación y que un jj abrams en 30 años más inventé porque paasó esa wea…perfecto…o es la fiebre que me está haciendo pensar weas.

3600749

Archivo: nido.org_1538202076398.mp4 (338.9 KB, 300×400px, 3:4, 16841742_389231021449967_2893963141731844096_n.mp4)

rico.

3600750

>>3600749
¿Qué IQ hay que tener para exponerte a algo así?

3600751

>>3600750
Jesús dice: No

3600752

>>3600750
Más que el haitiano promedio.

3600753

>>3600749
when quieres dejar de ser argentino

3600766

Archivo: nido.org_1538205482765.png (66.42 KB, 376×245px, 376:245, 1364283443230.png)

>>3600749
¿Como mierda vuelvo a dormir ahora?

3600785

Archivo: nido.org_1538208166427.mp4 (2.35 MB, 640×330px, 64:33, Soviet Jewish Control.mp4)


3601330

Archivo: nido.org_1538259014618.webm (3.43 MB, 1280×720px, 16:9, 701eb32630e5dbb3cc14fccfec05416b2eca89715369e8bff1ae7041486b0125.webm)


3601369

Archivo: nido.org_1538261247077.mp4 (4.99 MB, 200×356px, 50:89, single.mp4)


3601383

>>3601369
kek, es un haitiano culeandose una compatriota?

3601385

¿Y el video de la guagua aplastada por el camión?

3601390


3601395

>>3601383
verdad que acá hablamos inglés

3601396

>>3601330
kekaso

3601399

>>3601383
Tu nivel de retraso es: Potente

3601400

¿Alguien tiene el video sexual del día del plátano?

3601509

>>3601385

ahi sigue pajarón
>>3594998
Tu nivel de retraso es: Abundante

3601514

>>3601509
Ese no, retardado culiao.
Tu nivel de retraso es: Mísero

3601523

>>3601514

culiao pero no por voh
Jesús dice:

3601528

>>3599047
¿no entiendo el tipo era gay?

3601530

Archivo: nido.org_1538268070008.webm (5.82 MB, 854×480px, 427:240, 842086e85a14554b9a9c8296aec285c30e58a191b89ecb9aed1660acff22bacb.webm)


3601593

Archivo: nido.org_1538269882429.webm (1.39 MB, 480×480px, 1:1, eR7J.webm)


3601601

Archivo: nido.org_1538270313685.png (1.37 MB, 1920×1080px, 16:9, Sin título.png)

>>3601530
Cabecea un perro.

Pobre perrito

3601602

>>3601593
No entendi.

3601604

Archivo: nido.org_1538270426024.jpg (78.37 KB, 250×251px, 250:251, 114562125480791.jpg)

>>3601530
>motitos
<un simple perro te hace mierda
JJJAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

__
Enviado desde mi Silverado

3601605

Archivo: nido.org_1538270466007.mp4 (164.3 KB, 256×320px, 4:5, Kiss kiss fall in healing moicy Overwatch cosplay.mp4)


3601607

>>3601593
Yo a la izquierda.

3601611

>>3601602
Creo que discutieron y la mina está enojada. Pero el tipo está profundamente triste. La cosa es que de repente la mina quita la vista del celular y lo mira a el como con cara de vergüenza por andar dando pena.

3601613

>>3601593
No entendi

3601618

>>3601601
>ser yiop
>ir arrancando de unos chilenos que me quieren comer
>van pasando motos
>morir arrollado es más digno
>me tiro igual

3601626

>>3601593
vine a reír no a sentirme mal…o pajearme también.

3601659

Archivo: nido.org_1538272544239.webm (2.05 MB, 478×360px, 239:180, 0bd0099c91f13e74d26bb6b07c916bab5f30dd704086f0b7730d0e87b2dd491a.webm)


3601689

>>3601659
¿Por qué chucha empieza a gritar y acelera?

3601693

>>3601689
mujeres

3601695

>>3601689
>quiere ser inteligente
<nace mujer

3601707

>>3601689
Mujeres.

3601713

Archivo: nido.org_1538274285582.webm (2.41 MB, 640×360px, 16:9, nido.org_1509598203796.webm)


3601717

Archivo: nido.org_1538274520455.webm (1.03 MB, 640×400px, 8:5, Artés 2017.webm)


3601738

Archivo: nido.org_1538275242353.mp4 (1.19 MB, 640×360px, 16:9, One_Punch_Antifa.mp4)

recuerdo un par de videos jajiantes donde a lo lejos una tipa discute con un camionero y trata de parar el camion y le pasa encima, despues en otro mostraban como quedo la tipa

3601744

>>3597577
Qué rico, me tiraría esa negra.

3601759

>>3597577
weón que rico.

3601764

Archivo: nido.org_1538276428152.jpg (27.56 KB, 750×224px, 375:112, DoIvI8kUYAAvJzS.jpg)


3601906

>>3598052
Pobre Denis Danis

3602162

Archivo: nido.org_1538310191987.mp4 (1.83 MB, 640×360px, 16:9, nido.org_1538006206973.mp4)


3602163

Archivo: nido.org_1538310626867.webm (697.47 KB, 406×720px, 203:360, 1538283471732.webm)

Pero pongan weas buenas fomes culiaos hijos de la come moco

3602176

>>3602163
Joaquin?

3602736

1538190328989.webm
(704x528px, 1.94 MB)
1538198887517.webm
(720x404px, 678.77 KB)
1538329466297.webm
(300x224px, 2.7 MB)

China será la próxima superpoten-…

3602970

Archivo: nido.org_1538353744094.mp4 (2.14 MB, 352×640px, 11:20, 7c3181bea2e965a9923cbcd66e47360463860c36e36c8146707163e8f4d23c4e.mp4)


3602983

>>3602970
¿Qué le echó a la estufa? ¿Un tarro de aerosol?

3602994

>>3602736
>el niñito que queda vivo
Conchesumadre ;_;

3602999

Archivo: nido.org_1538355313567.png (52.85 KB, 198×205px, 198:205, tumblr_inline_oho203Cp6b1ri4d3y_540.png)

>>3602736
>el video del medio

3603011

>>3602983
unos chocolates fruna

3603012

>>3602994
para vengar a la familia

3603034

>>3602983
Silikon-spray

3603059

Archivo: nido.org_1538356737821.webm (2.89 MB, 640×360px, 16:9, 6UzB.webm)


3603110

Archivo: nido.org_1538358331439.mp4 (1.82 MB, 480×848px, 30:53, le pego.mp4)


3603115

Archivo: nido.org_1538358408380.mp4 (1.53 MB, 638×640px, 319:320, pica.mp4)


3603117

Archivo: nido.org_1538358459872.webm (5.64 MB, 640×480px, 4:3, 784946a96bd90b541a4ae55547a58c9f8f45a3bbb8df3d01d9ce256de947154a.webm)


3603125

Archivo: nido.org_1538358687311.jpg (4.28 KB, 225×225px, 1:1, que wea.jpg)

>>3603110
llegaron los enfermitos

3603139


3603152

Archivo: nido.org_1538359326528.png (85.71 KB, 160×160px, 1:1, GATOOOOOOO.png)


3603209

Archivo: nido.org_1538360570572.jpeg (660.68 KB, 750×932px, 375:466, 15117716.jpeg)


3603217

PODRÁ ESTE HILO SER INFINITO???
La caracola dice: Si tú quieres

3603227

Archivo: nido.org_1538361072528.mp4 (10.59 MB, 480×270px, 16:9, brazilisagoodplace.mp4)


3603230

Archivo: nido.org_1538361095792.webm (528.44 KB, 352×640px, 11:20, pajero.webm)


3603232

>>3603227
Llegaron los MALOTES

3603233

>>3603227
que linda forma de morir

3603324

Archivo: nido.org_1538363715357.jpg (36.65 KB, 417×480px, 139:160, 1536334484994.jpg)


3603559

Archivo: nido.org_1538370487738.webm (1.74 MB, 1280×720px, 16:9, 4p4A.webm)


3603560

Archivo: nido.org_1538370563578.mp4 (441.69 KB, 224×400px, 14:25, frases reflexiones y pensamientos.mp4)


3603563

Archivo: nido.org_1538370607327.mov (3.01 MB, 268×480px, 67:120, nido.org_1529335941730.mov)


3603564

Archivo: nido.org_1538370633592.jpg (73.64 KB, 640×640px, 1:1, beno.jpg)

>>3603559
Mas videos de guaguas muriendo

3603565

Archivo: nido.org_1538370645773.webm (1.58 MB, 960×720px, 4:3, G5qw.webm)


3603579

Archivo: nido.org_1538371233804.jpg (39.69 KB, 720×581px, 720:581, wena wena.jpg)

>>3603565
y uno acá quedando calvo siendo virgo.

3603593

>>3603559
Me dan ganas de pegarle a esa guagua

3603599

Archivo: nido.org_1538372876610.jpg (46.77 KB, 500×500px, 1:1, gojikek.jpg)


3603627

>>3570565
>>3580789
Con el agua dulce no flotai tomen nota

3603631

Archivo: nido.org_1538377507629.mp4 (3.06 MB, 1920×1080px, 16:9, The Time of Woman has Come - YouTube (1080p).mp4)


3603632

>>3580789
¿Qué lo mató, la posición en que cayó al agua o la altura de la que se tiró?

No es que quiera abrir una discusión técnica dentro de este maravilloso hilo, pero estoy con la duda

3603684

Archivo: nido.org_1538394802718.jpg (5.66 KB, 179×250px, 179:250, 1483376645631.jpg)

>>3603559
Perdí como chimpancé.

3604111

>>3603632
ambos tres

3604136

>>3603632
Ambas, la tensión superficial lo hizo pico.

3604153

Archivo: nido.org_1538421997033.mp4 (296.62 KB, 400×300px, 4:3, es sobre nigras verdad.mp4)


3604232

Archivo: nido.org_1538426227237.webm (927.75 KB, 336×420px, 4:5, 1527951087819.webm)


3604237

Archivo: nido.org_1538426605230.webm (1.55 MB, 1280×720px, 16:9, 1525491706851.webm)


3604242

>>3604237
borra eso

3604250

>>3604242
Selección natural

3604255

>>3604232
Qué buenos efectos especiales.
Mentira, penca la hueá.

3604273

Archivo: nido.org_1538428514570.webm (4.09 MB, 794×414px, 397:207, viernes.webm)


3604276

>>3604250
entonces por que degrees sigue vivo

3604520

Archivo: nido.org_1538441153664.mp4 (691.76 KB, 480×480px, 1:1, 0293b6237235f4ef4fab812236902b2a4dc29eda85596faf31cd387a24e99646.mp4)


3604530

>>3604520
jajeo leve, pero bueno igual..

3604534

Archivo: nido.org_1538441875404.mp4 (234.27 KB, 318×180px, 53:30, nido.org_1500859780800.mp4)


3604537

Archivo: nido.org_1538441958966.webm (3.84 MB, 528×297px, 16:9, nido.org_1510369885970.webm)


3604538

Archivo: nido.org_1538442004105.webm (2.52 MB, 640×360px, 16:9, to the fire.webm)


3604542

Archivo: nido.org_1538442167230.webm (1.46 MB, 720×480px, 3:2, ded bby.webm)


3604543

>>3604232
>lo sube sin sonido

TENÍAS UN SOLO TRABAJO

3604545

Archivo: nido.org_1538442222775.webm (3.79 MB, 480×360px, 4:3, 1532547019067.webm)


3604548

Archivo: nido.org_1538442328817.webm (1.95 MB, 1280×720px, 16:9, tortuguita.webm)


3604551

Archivo: nido.org_1538442398495.webm (3.76 MB, 372×550px, 186:275, Niñoporfiado.webm)


3604562

Archivo: nido.org_1538443294913.webm (2.97 MB, 352×640px, 11:20, f85b34b0a5c2a29f2e0913b0f7a8d8926344aa1e5f5be43551d899ca5936c0ce.webm)


3604574

Archivo: nido.org_1538443628507.jpg (36.11 KB, 640×480px, 4:3, teslawarned.jpg)


3604690

>>3604562
Hay muchas cosas en ese video que no comprendo.

3604704